Vaccine Structure Visualization



Element Description Position
cap A modified 5’-cap1 structure (m7G+m3'-5'-ppp-5'-Am). 1-2
5’-UTR 5´-untranslated region derived from human alpha-globin RNA with an optimized Kozak sequence. 3-54
sig S glycoprotein signal peptide (extended leader sequence), which guides translocation of the nascent polypeptide chain into the endoplasmic reticulum. 55-102
S protein_mut Codon-optimized sequence encoding full-length SARS-CoV-2 spike (S) glycoprotein containing mutations K986P and V987P to ensure the S glycoprotein remains in an antigenically optimal pre-fusion conformation; stop codons: 3874-3879 (underlined). 103-3879
3’-UTR The 3´ untranslated region comprises two sequence elements derived from the amino-terminal enhancer of split (AES) mRNA and the mitochondrial encoded 12S ribosomal RNA to confer RNA stability and high total protein expression. 3880-4174
poly(A) A 110-nucleotide poly(A)-tail consisting of a stretch of 30 adenosine residues, followed by a 10-nucleotide linker sequence and another 70 adenosine residues. 4175-4284

Squiggle Visualization

Mapping: A -> 10, G -> 11, C -> 01, Ψ -> 00

Yau Visualization

Gates Visualization

Images




Source: https://mednet-communities.net/inn/db/media/docs/11889.doc

Sequence

GAGAAΨAAACΨAGΨAΨΨCΨΨCΨGGΨCCCCACAGACΨCAGAGAGAACCCGCCACCAΨGΨΨCGΨGΨΨCCΨGGΨGCΨGCΨGCCΨCΨGGΨGΨCCAGCCAGΨGΨGΨGAACCΨGACCACCAGAACACAGCΨGCCΨCCAGCCΨACACCAACAGCΨΨΨACCAGAGGCGΨGΨACΨACCCCGACAAGGΨGΨΨCAGAΨCCAGCGΨGCΨGCACΨCΨACCCAGGACCΨGΨΨCCΨGCCΨΨΨCΨΨCAGCAACGΨGACCΨGGΨΨCCACGCCAΨCCACGΨGΨCCGGCACCAAΨGGCACCAAGAGAΨΨCGACAACCCCGΨGCΨGCCCΨΨCAACGACGGGGΨGΨACΨΨΨGCCAGCACCGAGAAGΨCCAACAΨCAΨCAGAGGCΨGGAΨCΨΨCGGCACCACACΨGGACAGCAAGACCCAGAGCCΨGCΨGAΨCGΨGAACAACGCCACCAACGΨGGΨCAΨCAAAGΨGΨGCGAGΨΨCCAGΨΨCΨGCAACGACCCCΨΨCCΨGGGCGΨCΨACΨACCACAAGAACAACAAGAGCΨGGAΨGGAAAGCGAGΨΨCCGGGΨGΨACAGCAGCGCCAACAACΨGCACCΨΨCGAGΨACGΨGΨCCCAGCCΨΨΨCCΨGAΨGGACCΨGGAAGGCAAGCAGGGCAACΨΨCAAGAACCΨGCGCGAGΨΨCGΨGΨΨΨAAGAACAΨCGACGGCΨACΨΨCAAGAΨCΨACAGCAAGCACACCCCΨAΨCAACCΨCGΨGCGGGAΨCΨGCCΨCAGGGCΨΨCΨCΨGCΨCΨGGAACCCCΨGGΨGGAΨCΨGCCCAΨCGGCAΨCAACAΨCACCCGGΨΨΨCAGACACΨGCΨGGCCCΨGCACAGAAGCΨACCΨGACACCΨGGCGAΨAGCAGCAGCGGAΨGGACAGCΨGGΨGCCGCCGCΨΨACΨAΨGΨGGGCΨACCΨGCAGCCΨAGAACCΨΨCCΨGCΨGAAGΨACAACGAGAACGGCACCAΨCACCGACGCCGΨGGAΨΨGΨGCΨCΨGGAΨCCΨCΨGAGCGAGACAAAGΨGCACCCΨGAAGΨCCΨΨCACCGΨGGAAAAGGGCAΨCΨACCAGACCAGCAACΨΨCCGGGΨGCAGCCCACCGAAΨCCAΨCGΨGCGGΨΨCCCCAAΨAΨCACCAAΨCΨGΨGCCCCΨΨCGGCGAGGΨGΨΨCAAΨGCCACCAGAΨΨCGCCΨCΨGΨGΨACGCCΨGGAACCGGAAGCGGAΨCAGCAAΨΨGCGΨGGCCGACΨACΨCCGΨGCΨGΨACAACΨCCGCCAGCΨΨCAGCACCΨΨCAAGΨGCΨACGGCGΨGΨCCCCΨACCAAGCΨGAACGACCΨGΨGCΨΨCACAAACGΨGΨACGCCGACAGCΨΨCGΨGAΨCCGGGGAGAΨGAAGΨGCGGCAGAΨΨGCCCCΨGGACAGACAGGCAAGAΨCGCCGACΨACAACΨACAAGCΨGCCCGACGACΨΨCACCGGCΨGΨGΨGAΨΨGCCΨGGAACAGCAACAACCΨGGACΨCCAAAGΨCGGCGGCAACΨACAAΨΨACCΨGΨACCGGCΨGΨΨCCGGAAGΨCCAAΨCΨGAAGCCCΨΨCGAGCGGGACAΨCΨCCACCGAGAΨCΨAΨCAGGCCGGCAGCACCCCΨΨGΨAACGGCGΨGGAAGGCΨΨCAACΨGCΨACΨΨCCCACΨGCAGΨCCΨACGGCΨΨΨCAGCCCACAAAΨGGCGΨGGGCΨAΨCAGCCCΨACAGAGΨGGΨGGΨGCΨGAGCΨΨCGAACΨGCΨGCAΨGCCCCΨGCCACAGΨGΨGCGGCCCΨAAGAAAAGCACCAAΨCΨCGΨGAAGAACAAAΨGCGΨGAACΨΨCAACΨΨCAACGGCCΨGACCGGCACCGGCGΨGCΨGACAGAGAGCAACAAGAAGΨΨCCΨGCCAΨΨCCAGCAGΨΨΨGGCCGGGAΨAΨCGCCGAΨACCACAGACGCCGΨΨAGAGAΨCCCCAGACACΨGGAAAΨCCΨGGACAΨCACCCCΨΨGCAGCΨΨCGGCGGAGΨGΨCΨGΨGAΨCACCCCΨGGCACCAACACCAGCAAΨCAGGΨGGCAGΨGCΨGΨACCAGGACGΨGAACΨGΨACCGAAGΨGCCCGΨGGCCAΨΨCACGCCGAΨCAGCΨGACACCΨACAΨGGCGGGΨGΨACΨCCACCGGCAGCAAΨGΨGΨΨΨCAGACCAGAGCCGGCΨGΨCΨGAΨCGGAGCCGAGCACGΨGAACAAΨAGCΨACGAGΨGCGACAΨCCCCAΨCGGCGCΨGGAAΨCΨGCGCCAGCΨACCAGACACAGACAAACAGCCCΨCGGAGAGCCAGAAGCGΨGGCCAGCCAGAGCAΨCAΨΨGCCΨACACAAΨGΨCΨCΨGGGCGCCGAGAACAGCGΨGGCCΨACΨCCAACAACΨCΨAΨCGCΨAΨCCCCACCAACΨΨCACCAΨCAGCGΨGACCACAGAGAΨCCΨGCCΨGΨGΨCCAΨGACCAAGACCAGCGΨGGACΨGCACCAΨGΨACAΨCΨGCGGCGAΨΨCCACCGAGΨGCΨCCAACCΨGCΨGCΨGCAGΨACGGCAGCΨΨCΨGCACCCAGCΨGAAΨAGAGCCCΨGACAGGGAΨCGCCGΨGGAACAGGACAAGAACACCCAAGAGGΨGΨΨCGCCCAAGΨGAAGCAGAΨCΨACAAGACCCCΨCCΨAΨCAAGGACΨΨCGGCGGCΨΨCAAΨΨΨCAGCCAGAΨΨCΨGCCCGAΨCCΨAGCAAGCCCAGCAAGCGGAGCΨΨCAΨCGAGGACCΨGCΨGΨΨCAACAAAGΨGACACΨGGCCGACGCCGGCΨΨCAΨCAAGCAGΨAΨGGCGAΨΨGΨCΨGGGCGACAΨΨGCCGCCAGGGAΨCΨGAΨΨΨGCGCCCAGAAGΨΨΨAACGGACΨGACAGΨGCΨGCCΨCCΨCΨGCΨGACCGAΨGAGAΨGAΨCGCCCAGΨACACAΨCΨGCCCΨGCΨGGCCGGCACAAΨCACAAGCGGCΨGGACAΨΨΨGGAGCAGGCGCCGCΨCΨGCAGAΨCCCCΨΨΨGCΨAΨGCAGAΨGGCCΨACCGGΨΨCAACGGCAΨCGGAGΨGACCCAGAAΨGΨGCΨGΨACGAGAACCAGAAGCΨGAΨCGCCAACCAGΨΨCAACAGCGCCAΨCGGCAAGAΨCCAGGACAGCCΨGAGCAGCACAGCAAGCGCCCΨGGGAAAGCΨGCAGGACGΨGGΨCAACCAGAAΨGCCCAGGCACΨGAACACCCΨGGΨCAAGCAGCΨGΨCCΨCCAACΨΨCGGCGCCAΨCAGCΨCΨGΨGCΨGAACGAΨAΨCCΨGAGCAGACΨGGACCCΨCCΨGAGGCCGAGGΨGCAGAΨCGACAGACΨGAΨCACAGGCAGACΨGCAGAGCCΨCCAGACAΨACGΨGACCCAGCAGCΨGAΨCAGAGCCGCCGAGAΨΨAGAGCCΨCΨGCCAAΨCΨGGCCGCCACCAAGAΨGΨCΨGAGΨGΨGΨGCΨGGGCCAGAGCAAGAGAGΨGGACΨΨΨΨGCGGCAAGGGCΨACCACCΨGAΨGAGCΨΨCCCΨCAGΨCΨGCCCCΨCACGGCGΨGGΨGΨΨΨCΨGCACGΨGACAΨAΨGΨGCCCGCΨCAAGAGAAGAAΨΨΨCACCACCGCΨCCAGCCAΨCΨGCCACGACGGCAAAGCCCACΨΨΨCCΨAGAGAAGGCGΨGΨΨCGΨGΨCCAACGGCACCCAΨΨGGΨΨCGΨGACACAGCGGAACΨΨCΨACGAGCCCCAGAΨCAΨCACCACCGACAACACCΨΨCGΨGΨCΨGGCAACΨGCGACGΨCGΨGAΨCGGCAΨΨGΨGAACAAΨACCGΨGΨACGACCCΨCΨGCAGCCCGAGCΨGGACAGCΨΨCAAAGAGGAACΨGGACAAGΨACΨΨΨAAGAACCACACAAGCCCCGACGΨGGACCΨGGGCGAΨAΨCAGCGGAAΨCAAΨGCCAGCGΨCGΨGAACAΨCCAGAAAGAGAΨCGACCGGCΨGAACGAGGΨGGCCAAGAAΨCΨGAACGAGAGCCΨGAΨCGACCΨGCAAGAACΨGGGGAAGΨACGAGCAGΨACAΨCAAGΨGGCCCΨGGΨACAΨCΨGGCΨGGGCΨΨΨAΨCGCCGGACΨGAΨΨGCCAΨCGΨGAΨGGΨCACAAΨCAΨGCΨGΨGΨΨGCAΨGACCAGCΨGCΨGΨAGCΨGCCΨGAAGGGCΨGΨΨGΨAGCΨGΨGGCAGCΨGCΨGCAAGΨΨCGACGAGGACGAΨΨCΨGAGCCCGΨGCΨGAAGGGCGΨGAAACΨGCACΨACACAΨGAΨGACΨCGAGCΨGGΨACΨGCAΨGCACGCAAΨGCΨAGCΨGCCCCΨΨΨCCCGΨCCΨGGGΨACCCCGAGΨCΨCCCCCGACCΨCGGGΨCCCAGGΨAΨGCΨCCCACCΨCCACCΨGCCCCACΨCACCACCΨCΨGCΨAGΨΨCCAGACACCΨCCCAAGCACGCAGCAAΨGCAGCΨCAAAACGCΨΨAGCCΨAGCCACACCCCCACGGGAAACAGCAGΨGAΨΨAACCΨΨΨAGCAAΨAAACGAAAGΨΨΨAACΨAAGCΨAΨACΨAACCCCAGGGΨΨGGΨCAAΨΨΨCGΨGCCAGCCACACCCΨGGAGCΨAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAΨAΨGACΨAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA